Procédé de dépistage de Xanthomonas axonopodis pv. phaseoli - Université d'Angers Accéder directement au contenu
Brevet Année : 2012

Procédé de dépistage de Xanthomonas axonopodis pv. phaseoli

Résumé

Screening Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprises detecting a combination (C1) of two genes of the combination AvrBsT/Xac3090, the combination AvrBsT/XopP, and the combination AvrBsT/AvrXccB, where the result of the screening process is positive if the presence of two genes of the combination (C1) is detected in the biological sample. Independent claims are included for: (1) a nucleotide probe or primer used in a method of screening Xanthomonas axonopodis pathovar phaseoli, where the primer or the probe has a length of 12-30 nucleotides and comprising at least 12 consecutive nucleotides from a nucleic acid of the nucleic acid sequence of SEQ ID NOs: 5-12 (e.g. ccatgctgagcacggtcatt (SEQ ID NO: 5), cgccttccagttgctgacat (SEQ ID NO: 6), acgagcccttcccaaactagc (SEQ ID NO: 7), taccaacatcgtacgcttccc (SEQ ID NO: 8), cgtcagtgagtgctcggttg (SEQ ID NO: 9) and tcagagccctggaagcaaga (SEQ ID NO: 10)), and the nucleic acids of complementary sequence; and (2) a kit for detection of Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprising two pairs of primers for amplifying the combination of the two genes (C1) and the nucleotide probe or primer.

La présente invention est relative à un procédé de dépistage de Xanthomonas axonopodis pv. phaseoli dans un échantillon biologique comprenant une étape de détection de la présence éventuelle d'une combinaison de deux gènes, ladite combinaison comprenant le gène AvrBsT et un gène choisi parmi le gène Xac3090, le gène XopP et le gène AvrXccB dans ledit échantillon. La présente invention a également pour objet des acides nucléiques utilisables en tant que sondes ou amorces pour la détection de ce pathovar dans un échantillon biologique et un kit de dépistage contenant au moins un desdits acides nucléiques.

Fichier non déposé

Dates et versions

hal-03256747 , version 1 (10-06-2021)

Identifiants

  • HAL Id : hal-03256747 , version 1
  • OKINA : ua13590

Citer

Tristan Boureau, Fabien Chhel, Gilles Hunault, Mohammed Kerkoud, Frédéric Lardeux, et al.. Procédé de dépistage de Xanthomonas axonopodis pv. phaseoli. France, N° de brevet: FR2970480 A1. 2012. ⟨hal-03256747⟩
45 Consultations
0 Téléchargements

Partager

Gmail Mastodon Facebook X LinkedIn More